Published November 11, 1980
| public
Journal Article
Open
Two Drosophila melanogaster tRNAGly genes are contained in a direct duplication at chromosomal locus 56F
- Creators
- Hershey, N. Davis
- Davidson, Norman
Abstract
One Drosophila melanogaster tRNAGly gene occurs on each 1.1 – 2.0 kb unit of a direct duplication at chromosomal region 56F. The nucleotide sequence of the gene and the 5' flanking region has been determined. The non-transcribed strand sequence of the tRNA gene is: 5' GCATCGGTGGTTCAGTGGTAGAATGCTCGCCTGCCACGCGGGCGGCCCGGGTTCGATTCCCGGCCGATGCA 3'. This nucleotide sequence is identical to that of the major glycine tRNA in Bombyx mori posterior silk gland. Within the 22 kb region mapped, additional tRNA genes are found, an observation consistent with reports that genes for other isoacceptors are present at this locus.
Additional Information
Copyright © 1980 Oxford University Press. Received 3 September 1980. We thank our collaborators, R. Robinson and P. Yen, for their participation in the construction of the DT library and isolation of λDmt56-6 and for numerous discussions about all aspects of this project. This work was supported by a grant from the NIH. Department of Chemistry Contribution Number 6300.Files
HERnar80.pdf
Files
(1.3 MB)
Name | Size | Download all |
---|---|---|
md5:45713194b3af6219bfe28faef44db3c2
|
1.3 MB | Preview Download |
Additional details
- Eprint ID
- 4064
- Resolver ID
- CaltechAUTHORS:HERnar80
- Created
-
2006-07-26Created from EPrint's datestamp field
- Updated
-
2019-10-02Created from EPrint's last_modified field